HomeServicesAboutResourcesBlogContactGet Started →
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG TTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCT GCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCAT
Home›About
About GeneOmics · EdGene Biomed

We exist because brilliant research shouldn't take an extra year to publish

GeneOmics is the cancer RNA-Seq, Transcriptomics and Metagenomics analysis service from EdGene Biomed — built on 13 years of genomics expertise and a deep understanding of what researchers actually need.

Our story

From workshops to services — 13 years in genomics

GeneOmics is the analysis services arm of EdGene Biomed — a bioinformatics education company that has trained researchers across India, the Middle East, and Southeast Asia.

Over years of workshops in India, Dubai, Bangkok, and online, one pattern repeated: researchers with deep biological knowledge and good data — stuck at the analysis step. Not because the analysis was impossible, but because rigorous bioinformatics expertise wasn't available to them on demand.

"I know the tools. I just can't get my data to publication."

GeneOmics was built to close that gap — not as a generic platform, but as a cancer-specialised RNA-Seq, Transcriptomics and Metagenomics service that speaks the language of oncology and microbiome researchers and delivers results their PIs and reviewers trust.

GeneOmics team — cancer RNA-Seq analysis specialists
2012
Founded
2000+
Researchers trained
Our mission

To remove the bioinformatics bottleneck from cancer research — so good science reaches publication at the speed the biology deserves.

We believe a researcher's time is too valuable to spend learning pipeline tools. That's what we're for.

What makes us different

Structural advantages no generic
bioinformatics provider can replicate

Four reasons researchers come back — and refer colleagues.

🎯

Cancer-only & Metagenomics specialisation

We work exclusively on oncology RNA-Seq, Transcriptomics and microbiome Metagenomics. We understand the difference between a TNBC dataset and a haematological malignancy — and how the gut microbiome connects to each.

🤖

AI speed + human rigour

AI-accelerated pipelines give us 5-day turnaround. Expert bioinformatician review gives you results that hold up to peer scrutiny. Both together is what makes us genuinely different.

📍

Deep India & Middle East roots

We've trained researchers at IISc, TIFR, NCBS, AIIMS, ACTREC and across the Gulf. We understand institutional budgets, grant structures, and timelines specific to these markets.

📖

Education-first heritage

Our background is teaching bioinformatics to non-bioinformaticians. Every report we write is designed to be understood — not just processed — by the researcher who commissioned it.

The team

The two people behind every analysis

Yash Shrivastava — Founder · Strategy & Client Relations
Yash Shrivastava
Founder · Strategy & Client Relations
First exposed to genome analysis technology in 2012. Has trained 2,000+ researchers across India and the Middle East through EdGene Biomed. Owns strategy, sales, client relations, and operations at GeneOmics.
Vandana Shrivastava — Co-Founder · Lead Bioinformatician
Vandana Shrivastava
Co-Founder · Lead Bioinformatician
Leads all RNA-Seq, Transcriptomics and Metagenomics analysis delivery. Every pipeline from QC through to final figures passes through her expert review before reaching the client — every single one.

Ready to work together?

Book a free 20-minute call to discuss your RNA-Seq or Metagenomics project.