HomeServicesAboutResourcesBlogContactGet Started →
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG TTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCGATCGATCGATCGATCGATCG
HomeContact
Contact · Book a Free Call

Talk to us before you decide anything

Book a free 20-minute call. We'll tell you honestly whether your data is ready, which approach makes sense for your RNA-Seq or Metagenomics project, and what it would cost.

📅

Book a free call

20 minutes. We'll review your RNA-Seq or Metagenomics project, confirm data readiness, and give you an honest cost estimate.

Book via form below ↓
📧

Email us directly

Send project details and we'll respond within 4 hours (Mon–Sat, 9am–7pm IST). Attach your experimental design if you have it.

contact@edgeneomics.com
💬

WhatsApp

For quick questions or warm enquiries from EdGene alumni. Responds during business hours. Best for follow-ups.

+91-XXXXXXXXXX

Tell us about your project

You'll receive a confirmation with a calendar invite within 2 hours · Mon–Sat, 9am–7pm IST

Honest advice, zero obligation

In 20 minutes we can tell you whether your data is analysis-ready, which RNA-Seq or Metagenomics approach fits your study, and what results would realistically cost. No sales pitch.

📧
Email
contact@edgeneomics.com
💬
WhatsApp
+91-XXXXXXXXXX
Response time
Within 4 hours, Mon–Sat 9am–7pm IST
🌍
Clients served
India · UAE · Saudi Arabia · Global
📍

Bangalore · Mumbai · Delhi
India & Middle East

in𝕏R@
🎉 Early access still available
First 15 clients get 50% off all projects. Mention early access on the call to lock in pricing.
Before you call

Common questions

Yes, genuinely free. We give you honest technical advice regardless of whether it leads to a project. If your data isn't analysis-ready, we'll tell you what it needs. If a cheaper alternative would serve you better, we'll say so. We'd rather earn your trust than your money on a project that doesn't fit.
Just a general sense of your experimental design — how many samples, what the comparison groups are, and what biological question you're trying to answer. You don't need your data in front of you. We'll ask the right questions.
Yes. Email us at contact@edgeneomics.com with your experimental design, number of samples, and whether you're interested in RNA-Seq, Metagenomics, or both. We'll review and respond with a feasibility confirmation within 24 hours.
Yes. We work with researchers globally across India, UAE, Saudi Arabia, UK and beyond. All file transfer, communication, and deliverables are handled remotely. We accept payment in INR, USD, AED, and GBP. Calls can be scheduled across all major time zones.
India: NEFT / RTGS / UPI / Razorpay. International: Stripe (USD / GBP / AED). For institutional clients we support PO-based procurement and GST invoices. Terms: 50% upfront, 50% on delivery for all projects.