HomeServicesAboutResourcesBlogContactGet Started →
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG TTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCGATCGATCGATCGATCGATCG
Home›Resources
Free Resources · Ebook · Sample Report · Checklist

Tools that help you regardless of whether you work with us

Three free resources for cancer and microbiome researchers — an ebook, a pre-analysis checklist, and a complete sample RNA-Seq analysis report.

Free resources

Everything you need to make a confident
decision about your next analysis

All three resources are genuinely useful — whether or not you ever become a client. No artificial value removal, no content gating with a drip campaign.

📘

7 RNA-Seq Mistakes Ebook

18 pages covering the most common Differential Gene Expression Analysis errors in cancer labs — with specific fixes for each.

Get it free
✅

Pre-Analysis Checklist

One-page PDF: 12 checkpoints to run through before starting any RNA-Seq or Metagenomics analysis. No email required.

Get it free
📊

Sample Analysis Report

A complete RNA-Seq analysis report in the exact format and quality a paying client receives — QC, DEGs, GSEA, TCGA validation.

Get it free
📘 Free ebook

"7 RNA-Seq Analysis Mistakes That Delay Your Cancer Publication"

18 pages. No filler. Based on the Differential Gene Expression Analysis errors we see most often in cancer and microbiome research labs.

✓Why your PCA looks wrong — and how to fix it
✓The batch effect you probably didn't correct for
✓What reviewers now expect from Transcriptomics analyses
✓TCGA validation — when and how to include it
✓Statistical model choice for your experimental design
✓Figure quality standards for high-impact oncology journals

No spam. Unsubscribe anytime.

✅ Free checklist — no email required

"Before You Run DESeq2: A 12-Point Pre-Analysis Checklist"

One page. Print it. Run through it before every RNA-Seq analysis. No email required — just a direct download, because a checklist should be frictionless.

Raw FASTQ files verified and backed up
Sample metadata sheet complete
Sequencing depth per sample reviewed
Strand-specificity confirmed
Reference genome version noted
Experimental design documented
Batch variables identified
Minimum replicate count checked
Quality scores reviewed (FastQC)
Adapter contamination checked
rRNA contamination assessed
Alignment rate target confirmed
Download free checklist (PDF) →
🔥 Most requested — Sample analysis report

See exactly what a GeneOmics RNA-Seq deliverable looks like

A complete cancer Differential Gene Expression Analysis report — the same format and quality as a paying client receives. TNBC dataset, real gene names, full GSEA and TCGA validation.

✓Full QC report and alignment statistics
✓DEG tables with ABCB1, TWIST1, ESR1 — real gene names
✓Publication-ready volcano plots and heatmaps (300 DPI)
✓GSEA Hallmark pathway enrichment results
✓TCGA survival validation section
✓Methods text ready for manuscript submission

No spam. Unsubscribe anytime.

🎉 Early access — limited slots

Reserve your spot before we open to the public

First 15 clients get 50% off all projects, priority onboarding, and a direct WhatsApp channel with our team.

✓ 50% off first project
✓ Priority 3-day turnaround
✓ Direct WhatsApp channel
✓ 15 slots only

No payment. No spam. Personal follow-up — not a drip campaign.

Not ready to commit yet?

Download the sample report first — see exactly what you'd receive before deciding anything.