HomeServicesAboutResourcesBlogContactGet Started →
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG TTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCGATCGATCGATCGATCGATCG
Home›Blog
Cancer Bioinformatics Blog · RNA-Seq · Metagenomics

Cancer bioinformatics, explained clearly

Practical guides, tutorials, and honest opinions on RNA-Seq, Transcriptomics, Metagenomics and cancer bioinformatics. Written by practitioners, for researchers.

Featured
7 RNA-Seq Mistakes featured blog post
Tutorial
May 2026 · 8 min read

The 7 RNA-Seq Analysis Mistakes That Delay Your Cancer Research Publication

From batch effect blindness to over-relying on p-values — the Differential Gene Expression Analysis errors we see most often in oncology labs, and how to fix each one before you submit.

Read article →
The 7 RNA-Seq Analysis Mistakes That Delay Your Cancer Research Publication Tutorial
May 2026 · 8 min read

The 7 RNA-Seq Analysis Mistakes That Delay Your Cancer Research Publication

From batch effect blindness to over-relying on p-values — the Differential Gene Expression Analysis errors we see most in oncology labs, and how to fix each one.

Read article →
How to Use TCGA Data to Validate Your Cancer RNA-Seq Findings Guide
May 2026 · 12 min read

How to Use TCGA Data to Validate Your Cancer RNA-Seq Findings

Step-by-step guide to using TCGAbiolinks to validate Differential Gene Expression Analysis results with patient survival data from The Cancer Genome Atlas.

Read article →
Why Galaxy Is Slowing Your Research Down (And What to Use Instead) Opinion
April 2026 · 6 min read

Why Galaxy Is Slowing Your Research Down (And What to Use Instead)

An honest look at why the most popular free RNA-Seq tool creates more Transcriptomics analysis problems than it solves for cancer researchers.

Read article →
DESeq2 vs edgeR: Which Should You Use for Your Cancer Transcriptomics Data? Tutorial
April 2026 · 10 min read

DESeq2 vs edgeR: Which Should You Use for Your Cancer Transcriptomics Data?

A practical comparison of the two most widely used Differential Gene Expression Analysis tools and when each is the right choice for your experimental design.

Read article →
16S rRNA vs Shotgun Metagenomics: Which Approach Is Right for Your Study? Metagenomics
March 2026 · 9 min read

16S rRNA vs Shotgun Metagenomics: Which Approach Is Right for Your Study?

A practical guide to choosing between amplicon-based and whole-genome shotgun Metagenomics for cancer microbiome and gut-tumour axis research.

Read article →
How to Interpret a Volcano Plot: What the Points Actually Mean Guide
March 2026 · 8 min read

How to Interpret a Volcano Plot: What the Points Actually Mean

Beyond the basics — how to read a volcano plot in the context of your cancer Transcriptomics data rather than just applying fold-change cutoffs.

Read article →
From Archived Data to Published Biomarkers: How Re-Analysis Rescued a Stalled Project Case Study
February 2026 · 11 min read

From Archived Data to Published Biomarkers: How Re-Analysis Rescued a Stalled Project

How a 14-month-old TNBC RNA-Seq dataset was re-analysed with updated pipelines and TCGA validation to produce two novel biomarker candidates ready for submission.

Read article →
The Gut-Tumour Axis: Integrating Metagenomics with RNA-Seq Transcriptomics Metagenomics
February 2026 · 10 min read

The Gut-Tumour Axis: Integrating Metagenomics with RNA-Seq Transcriptomics

How to design a multi-omics study combining shotgun Metagenomics microbiome profiling with host cancer Transcriptomics, and what analysis pipeline to use.

Read article →
Your p-value Is Fine. Your Biology Interpretation Isn't. Opinion
January 2026 · 7 min read

Your p-value Is Fine. Your Biology Interpretation Isn't.

Why statistical significance is the beginning of interpretation in cancer Transcriptomics, not the end — and what peer reviewers are increasingly asking for.

Read article →
Newsletter

Cancer bioinformatics tips, twice a month

No product updates. No company news. Just practical RNA-Seq, Transcriptomics and Metagenomics tips from the team.

No spam. Unsubscribe anytime.

Have RNA-Seq or Metagenomics data
that needs analysing?

We deliver publication-ready results in 5 business days. Book a free call to discuss your project.