HomeServicesAboutResourcesBlogContactGet Started →
ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG TTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCGATCGATCGATCGATCGATCG
HomeBlog
Cancer Bioinformatics Blog · RNA-Seq · Metagenomics

Cancer bioinformatics, explained clearly

Practical guides, tutorials, and honest opinions on RNA-Seq, Transcriptomics, Metagenomics and cancer bioinformatics. Written by practitioners, for researchers.

Featured
7 RNA-Seq Mistakes featured blog post
Tutorial
May 2026 · 8 min read

The 7 RNA-Seq Analysis Mistakes That Delay Your Cancer Research Publication

From batch effect blindness to over-relying on p-values — the Differential Gene Expression Analysis errors we see most often in oncology labs, and how to fix each one before you submit.

Read article →
The 7 RNA-Seq Analysis Mistakes That Delay Your Cancer Research Publication Tutorial
May 2026 · 8 min read

The 7 RNA-Seq Analysis Mistakes That Delay Your Cancer Research Publication

From batch effect blindness to over-relying on p-values — the Differential Gene Expression Analysis errors we see most in oncology labs, and how to fix each one.

Read article
How to Use TCGA Data to Validate Your Cancer RNA-Seq Findings Guide
May 2026 · 12 min read

How to Use TCGA Data to Validate Your Cancer RNA-Seq Findings

Step-by-step guide to using TCGAbiolinks to validate Differential Gene Expression Analysis results with patient survival data from The Cancer Genome Atlas.

Read article
Why Galaxy Is Slowing Your Research Down (And What to Use Instead) Opinion
April 2026 · 6 min read

Why Galaxy Is Slowing Your Research Down (And What to Use Instead)

An honest look at why the most popular free RNA-Seq tool creates more Transcriptomics analysis problems than it solves for cancer researchers.

Read article
DESeq2 vs edgeR: Which Should You Use for Your Cancer Transcriptomics Data? Tutorial
April 2026 · 10 min read

DESeq2 vs edgeR: Which Should You Use for Your Cancer Transcriptomics Data?

A practical comparison of the two most widely used Differential Gene Expression Analysis tools and when each is the right choice for your experimental design.

Read article
16S rRNA vs Shotgun Metagenomics: Which Approach Is Right for Your Study? Metagenomics
March 2026 · 9 min read

16S rRNA vs Shotgun Metagenomics: Which Approach Is Right for Your Study?

A practical guide to choosing between amplicon-based and whole-genome shotgun Metagenomics for cancer microbiome and gut-tumour axis research.

Read article
How to Interpret a Volcano Plot: What the Points Actually Mean Guide
March 2026 · 8 min read

How to Interpret a Volcano Plot: What the Points Actually Mean

Beyond the basics — how to read a volcano plot in the context of your cancer Transcriptomics data rather than just applying fold-change cutoffs.

Read article
From Archived Data to Published Biomarkers: How Re-Analysis Rescued a Stalled Project Case Study
February 2026 · 11 min read

From Archived Data to Published Biomarkers: How Re-Analysis Rescued a Stalled Project

How a 14-month-old TNBC RNA-Seq dataset was re-analysed with updated pipelines and TCGA validation to produce two novel biomarker candidates ready for submission.

Read article
The Gut-Tumour Axis: Integrating Metagenomics with RNA-Seq Transcriptomics Metagenomics
February 2026 · 10 min read

The Gut-Tumour Axis: Integrating Metagenomics with RNA-Seq Transcriptomics

How to design a multi-omics study combining shotgun Metagenomics microbiome profiling with host cancer Transcriptomics, and what analysis pipeline to use.

Read article
Your p-value Is Fine. Your Biology Interpretation Isn't. Opinion
January 2026 · 7 min read

Your p-value Is Fine. Your Biology Interpretation Isn't.

Why statistical significance is the beginning of interpretation in cancer Transcriptomics, not the end — and what peer reviewers are increasingly asking for.

Read article
Newsletter

Cancer bioinformatics tips, twice a month

No product updates. No company news. Just practical RNA-Seq, Transcriptomics and Metagenomics tips from the team.

No spam. Unsubscribe anytime.

Have RNA-Seq or Metagenomics data
that needs analysing?

We deliver publication-ready results in 5 business days. Book a free call to discuss your project.